Sample ID: MP23-0431_matK
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:15 |
| Analysis completed | 2025-05-03 01:28:15 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Planta. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Planta | |
| Coverage of species in genus Planta | |
| Coverage of species in genus Planta in country of origin Indonesia |
Flag 5.1C:
The reference data are likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Planta at the given locus matK.
Global occurrence records for Planta.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The reference data offers little support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus matK
Flag 5.3C:
It’s unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample’s country of origin
Reasoning: No species in genus have been observed in the country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus matK
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
| Locus | matK |
| Preliminary ID | Planta |
| Taxa of interest |
Nicotiana tabacum |
| Country | Indonesia |
| Host | NA |
| Sample ID | MP23-0431_matK |
| Query DNA sequence |
>MP23-0431_matK TACGCCCAAATCGGTCAATAATATCAGAATCTGATAAATCGGACCAAACCGGTTTACTAA TGGGATGCCCTAATACGGTACAAAAGTTTGCTTTAGCTAATGATCCAATCAAAGGAATAA TTGGAACAAGGGTATCGAACTTCTTAATTGCATTATTGATTAGAAATGAATTTTCTAACA TTTGACTACGTACCATTGAAGGATTTAGTCGCACACTTGAAAGATAGCCCATAAAGTCAC GGGAATGATTGGATAATTGGTTTATATGGATCCTTCCTGTGTGAAAGCACAGAGAACAAT GACATTGCCAAAAATTGACAAGGTAAAATTTCCATTTATTCATCAAAAGAAACGTCCCTT TTGAAGCCAGAATGGATTTTCCTTGATACCTAACATAATGCATGAAAGGATCCTTGAATA ACCATAGGGTAACCTGAAAATCCTTAGCAAAGACTTCTACAAGACGTTCTATTTTTCCAT AGAAATATATTCGTTCAAGAAGGGCTCCAAAAGATGTTGATCGTAAATGAGAAGATTGGT TCCGTAGAAAGACGAAAGTGGATTCGCATTCATATACATAAGAATTATATAAGAAGAAGA AGAATCTTTGATTTTTTTTTGAAAAGGAGTAACCGGGCTTCTTTGAAGTAATAAGACTAT TCAAATTCCAAAATTCATGGAGAAAGAATCGTAATAAATGTAAAGAAGAGGCATCTTTTA CCCAATAGCGAA
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 478 | 131 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Nicotiana glutinosa x Nicotiana tabacum | 1 | 100.0% | 0.0 |
Database coverage of Candidate Nicotiana glutinosa x Nicotiana tabacumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana tabacum | 18 | 100.0% | 0.0 |
Database coverage of Candidate Nicotiana tabacumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana sylvestris | 2 | 100.0% | 0.0 |
Database coverage of Candidate Nicotiana sylvestrisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana bonariensis | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana bonariensisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana attenuata | 4 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana attenuataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana x sanderae | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana x sanderaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana alata | 2 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana alataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana langsdorffii | 1 | 99.7% | 0.0 |
Database coverage of Candidate Nicotiana langsdorffiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana benthamiana | 12 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana benthamianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana goodspeedii | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana goodspeediiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana forgetiana | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana forgetianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana gossei | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana gosseiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana plumbaginifolia | 2 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana plumbaginifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana umbratica | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana umbraticaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana longiflora | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana longifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana occidentalis | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana occidentalisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana suaveolens | 3 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana suaveolensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana simulans | 1 | 99.6% | 0.0 |
Database coverage of Candidate Nicotiana simulansThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana sp. 'rastroensis' | 1 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana sp. 'rastroensis'This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana exigua | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana exiguaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana amplexicaulis | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana amplexicaulisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana repanda | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana repandaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana nesophila | 1 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana nesophilaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana megalosiphon | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana megalosiphonThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana debneyi | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana debneyiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana stocktonii | 2 | 99.5% | 0.0 |
Database coverage of Candidate Nicotiana stocktoniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana rotundifolia | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana rotundifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana glauca | 8 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana glaucaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana noctiflora | 4 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana noctifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana linearis | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana linearisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana maritima | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana maritimaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana nudicaulis | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana nudicaulisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana miersii | 2 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana miersiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana rosulata | 1 | 99.3% | 0.0 |
Database coverage of Candidate Nicotiana rosulataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana cavicola | 1 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana cavicolaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| synthetic construct | 1 | 99.2% | 0.0 |
Database coverage of Candidate synthetic constructThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana arentsii | 1 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana arentsiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana fragrans | 1 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana fragransThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana wigandioides | 1 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana wigandioidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana undulata | 2 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana undulataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana solanifolia | 2 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana solanifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana petunioides | 1 | 99.2% | 0.0 |
Database coverage of Candidate Nicotiana petunioidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana corymbosa | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nicotiana corymbosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana benavidesii | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nicotiana benavidesiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana glutinosa | 1 | 99.0% | 0.0 |
Database coverage of Candidate Nicotiana glutinosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana cordifolia | 1 | 98.9% | 0.0 |
Database coverage of Candidate Nicotiana cordifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana raimondii | 1 | 98.9% | 0.0 |
Database coverage of Candidate Nicotiana raimondiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana otophora | 3 | 98.9% | 0.0 |
Database coverage of Candidate Nicotiana otophoraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Trompettia cardenasiana | 2 | 98.9% | 0.0 |
Database coverage of Candidate Trompettia cardenasianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana thyrsiflora | 1 | 98.9% | 0.0 |
Database coverage of Candidate Nicotiana thyrsifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana acaulis | 1 | 98.9% | 0.0 |
Database coverage of Candidate Nicotiana acaulisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana tomentosa | 1 | 98.8% | 0.0 |
Database coverage of Candidate Nicotiana tomentosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana tomentosiformis | 2 | 98.8% | 0.0 |
Database coverage of Candidate Nicotiana tomentosiformisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium ferocissimum | 219 | 98.6% | 0.0 |
Database coverage of Candidate Lycium ferocissimumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium chinense | 11 | 98.6% | 0.0 |
Database coverage of Candidate Lycium chinenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium barbarum | 21 | 98.6% | 0.0 |
Database coverage of Candidate Lycium barbarumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana quadrivalvis | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nicotiana quadrivalvisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana kawakamii | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nicotiana kawakamiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium dasystemum | 5 | 98.6% | 0.0 |
Database coverage of Candidate Lycium dasystemumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx australis | 2 | 98.6% | 0.0 |
Database coverage of Candidate Eriolarynx australisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium yunnanense | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium yunnanenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma ellipticum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma ellipticumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis myosotidea | 1 | 98.6% | 0.0 |
Database coverage of Candidate Anthocercis myosotideaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana trigonophylla | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nicotiana trigonophyllaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx lorentzii | 1 | 98.6% | 0.0 |
Database coverage of Candidate Eriolarynx lorentziiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Saracha punctata | 3 | 98.6% | 0.0 |
Database coverage of Candidate Saracha punctataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Salpichroa origanifolia | 1 | 98.6% | 0.0 |
Database coverage of Candidate Salpichroa origanifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis angustifolia | 1 | 98.6% | 0.0 |
Database coverage of Candidate Anthocercis angustifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium sp. | 10 | 98.6% | 0.0 |
Database coverage of Candidate Lycium sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium pilifolium | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium pilifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Vassobia dichotoma | 2 | 98.6% | 0.0 |
Database coverage of Candidate Vassobia dichotomaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nolana rostrata | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nolana rostrataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium europaeum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium europaeumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana palmeri | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nicotiana palmeriThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthotroche blackii | 1 | 98.6% | 0.0 |
Database coverage of Candidate Anthotroche blackiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthotroche pannosa | 1 | 98.6% | 0.0 |
Database coverage of Candidate Anthotroche pannosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Acnistus arborescens x Iochroma cyaneum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Acnistus arborescens x Iochroma cyaneumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium hybrid cultivar | 3 | 98.6% | 0.0 |
Database coverage of Candidate Lycium hybrid cultivarThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma nitidum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma nitidumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Eriolarynx fasciculata | 1 | 98.6% | 0.0 |
Database coverage of Candidate Eriolarynx fasciculataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium cinereum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium cinereumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma salpoanum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma salpoanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium edgeworthii | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium edgeworthiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium australe | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium australeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dunalia brachyacantha | 2 | 98.6% | 0.0 |
Database coverage of Candidate Dunalia brachyacanthaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium ruthenicum | 2 | 98.6% | 0.0 |
Database coverage of Candidate Lycium ruthenicumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma peruvianum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma peruvianumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma stenanthum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma stenanthumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium mascarenense | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium mascarenenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma loxense | 1 | 98.6% | 0.0 |
Database coverage of Candidate Iochroma loxenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium shawii | 3 | 98.6% | 0.0 |
Database coverage of Candidate Lycium shawiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Acnistus arborescens | 2 | 98.6% | 0.0 |
Database coverage of Candidate Acnistus arborescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nothocestrum latifolium | 1 | 98.6% | 0.0 |
Database coverage of Candidate Nothocestrum latifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium cylindricum | 3 | 98.6% | 0.0 |
Database coverage of Candidate Lycium cylindricumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium villosum | 1 | 98.6% | 0.0 |
Database coverage of Candidate Lycium villosumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium truncatum | 3 | 98.6% | 0.0 |
Database coverage of Candidate Lycium truncatumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium schizocalyx | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium schizocalyxThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium carolinianum | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium carolinianumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium morongii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium morongiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania somnifera | 1 | 98.5% | 0.0 |
Database coverage of Candidate Withania somniferaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana knightiana | 3 | 98.5% | 0.0 |
Database coverage of Candidate Nicotiana knightianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Brachistus nelsonii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Brachistus nelsoniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma lehmannii | 2 | 98.5% | 0.0 |
Database coverage of Candidate Iochroma lehmanniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Cyphanthera microphylla | 1 | 98.5% | 0.0 |
Database coverage of Candidate Cyphanthera microphyllaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthotroche walcottii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Anthotroche walcottiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma umbellatum | 1 | 98.5% | 0.0 |
Database coverage of Candidate Iochroma umbellatumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium prunus-spinosa | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium prunus-spinosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthotroche myoporoides | 1 | 98.5% | 0.0 |
Database coverage of Candidate Anthotroche myoporoidesThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium amarum | 3 | 98.5% | 0.0 |
Database coverage of Candidate Lycium amarumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana clevelandii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Nicotiana clevelandiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Datura inoxia | 3 | 98.5% | 0.0 |
Database coverage of Candidate Datura inoxiaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana obtusifolia | 1 | 98.5% | 0.0 |
Database coverage of Candidate Nicotiana obtusifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Withania frutescens | 2 | 98.5% | 0.0 |
Database coverage of Candidate Withania frutescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma tingoanum | 1 | 98.5% | 0.0 |
Database coverage of Candidate Iochroma tingoanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Cyphanthera albicans | 1 | 98.5% | 0.0 |
Database coverage of Candidate Cyphanthera albicansThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Datura stramonium | 2 | 98.5% | 0.0 |
Database coverage of Candidate Datura stramoniumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Iochroma cyaneum | 2 | 98.5% | 0.0 |
Database coverage of Candidate Iochroma cyaneumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana paniculata | 1 | 98.5% | 0.0 |
Database coverage of Candidate Nicotiana paniculataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Saracha nigribaccata | 2 | 98.5% | 0.0 |
Database coverage of Candidate Saracha nigribaccataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium elliotii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium elliotiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Lycium schweinfurthii | 1 | 98.5% | 0.0 |
Database coverage of Candidate Lycium schweinfurthiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis intricata | 1 | 98.5% | 0.0 |
Database coverage of Candidate Anthocercis intricataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Dunalia obovata | 1 | 98.5% | 0.0 |
Database coverage of Candidate Dunalia obovataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis sylvicola | 1 | 98.5% | 0.0 |
Database coverage of Candidate Anthocercis sylvicolaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Leucophysalis grandiflora | 1 | 98.5% | 0.0 |
Database coverage of Candidate Leucophysalis grandifloraThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nicotiana rustica | 2 | 98.5% | 0.0 |
Database coverage of Candidate Nicotiana rusticaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Anthocercis viscosa | 1 | 98.5% | 0.0 |
Database coverage of Candidate Anthocercis viscosaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora officinarum | 1 | 98.5% | 0.0 |
Database coverage of Candidate Mandragora officinarumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Nolana albescens | 1 | 98.5% | 0.0 |
Database coverage of Candidate Nolana albescensThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Mandragora turcomanica | 1 | 98.5% | 0.0 |
Database coverage of Candidate Mandragora turcomanicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Trozelia umbellata | 1 | 98.5% | 0.0 |
Database coverage of Candidate Trozelia umbellataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | AJ585853 | Nicotiana digluta plastid matK gene for maturase K | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 2 | AP019624 | Nicotiana tabacum apxA_T2_120719 chloroplast DNA, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 3 | OQ473890 | Nicotiana tabacum isolate PilotoCubano chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 4 | AP019623 | Nicotiana tabacum SR1_120719 chloroplast DNA, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 5 | MZ707522 | Nicotiana tabacum chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 6 | KU199713 | Nicotiana tabacum cultivar TN90 plastid, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 7 | NC_007500 | Nicotiana sylvestris chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 8 | NC_001879 | Nicotiana tabacum plastid, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 9 | OQ473888 | Nicotiana tabacum isolate Hainan2 chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 10 | OQ473889 | Nicotiana tabacum isolate Hainan3 chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 11 | AB039998 | Nicotiana sylvestris chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 12 | OQ289904 | Nicotiana tabacum voucher Anastasio Sotero 20691 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 13 | KJ652184 | Nicotiana tabacum maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 14 | OQ473886 | Nicotiana tabacum isolate 7-CX14 chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 15 | OQ473887 | Nicotiana tabacum isolate 189802E-Habana2000 chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 16 | HQ619839 | Nicotiana tabacum isolate LegMedMO_115 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 17 | AP019626 | Nicotiana tabacum apxC_T2_120719 chloroplast DNA, mini circle chloroplast, complete genome | 732 | 100.0% | 1451.51 | 0.00e+00 | 100.0% |
| 18 | JN114764 | Nicotiana tabacum voucher SBB-0480 maturase K (matK) gene, partial cds; chloroplast | 700 | 95.6% | 1388.08 | 0.00e+00 | 100.0% |
| 19 | OQ290553 | Nicotiana tabacum voucher Miriam Jimenez Chimil 30585 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 700 | 95.6% | 1388.08 | 0.00e+00 | 100.0% |
| 20 | AB039986 | Nicotiana bonariensis chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1435.65 | 0.00e+00 | 99.7% |
| 21 | AB040009 | Nicotiana attenuata chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1435.65 | 0.00e+00 | 99.7% |
| 22 | AJ585841 | Nicotiana x sanderae plastid matK gene for maturase K | 732 | 100.0% | 1435.65 | 0.00e+00 | 99.7% |
| 23 | AB040000 | Nicotiana alata chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1435.65 | 0.00e+00 | 99.7% |
| 24 | AB039999 | Nicotiana langsdorfii chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1435.65 | 0.00e+00 | 99.7% |
| 25 | LC742734 | Nicotiana benthamiana Nb8 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 26 | LC617402 | Nicotiana benthamiana NbWT_20_0_01 chloroplast matK gene for Maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 27 | LC742727 | Nicotiana benthamiana Nb1 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 28 | KX783723 | Nicotiana alata voucher Hosam00280 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 29 | LC742731 | Nicotiana benthamiana Nb5 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 30 | LC742733 | Nicotiana benthamiana Nb7 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 31 | LC742736 | Nicotiana benthamiana Nb10 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 32 | AJ585890 | Nicotiana goodspeedii plastid matK gene for maturase K | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 33 | AB040001 | Nicotiana forgetiana chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 34 | LC742735 | Nicotiana benthamiana Nb9 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 35 | AB040018 | Nicotiana gossei chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 36 | LC742728 | Nicotiana benthamiana Nb2 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 37 | AB040003 | Nicotiana plumbaginifolia chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 38 | AB040015 | Nicotiana umbratica chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 39 | AB040002 | Nicotiana longiflora chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 40 | AJ585889 | Nicotiana occidentalis plastid matK gene for maturase K | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 41 | AB040014 | Nicotiana benthamiana chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 42 | KP756840 | Nicotiana suaveolens isolate R091 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 43 | LC742732 | Nicotiana benthamiana Nb6 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 44 | LC742729 | Nicotiana benthamiana Nb3 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 45 | AB040020 | Nicotiana simulans chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 46 | LC742730 | Nicotiana benthamiana Nb4 chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 47 | LC649170 | Nicotiana plumbaginifolia YN25 chloroplast, complete genome | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.6% |
| 48 | KP756808 | Nicotiana sp. 'rastroensis' tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1427.72 | 0.00e+00 | 99.5% |
| 49 | NC_056978 | Nicotiana suaveolens chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 50 | AJ585842 | Nicotiana suaveolens plastid matK gene for maturase K | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 51 | AB040022 | Nicotiana exigua chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 52 | NC_056976 | Nicotiana amplexicaulis chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 53 | NC_056981 | Nicotiana repanda chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 54 | AB040004 | Nicotiana repanda chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 55 | AJ585856 | Nicotiana exigua plastid matK gene for maturase K | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 56 | AJ585854 | Nicotiana nesophila plastid matK gene for maturase K | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 57 | AB040019 | Nicotiana amplexicaulis chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 58 | AJ585855 | Nicotiana megalosiphon plastid matK gene for maturase K | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 59 | MG182422 | Nicotiana attenuata chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 60 | AB040017 | Nicotiana debneyi chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 61 | AB040005 | Nicotiana stocktonii chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 62 | NC_035952 | Nicotiana attenuata chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 63 | NC_056980 | Nicotiana stocktonii chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 64 | NC_056977 | Nicotiana debneyi chloroplast, complete genome | 732 | 100.0% | 1419.79 | 0.00e+00 | 99.5% |
| 65 | AJ585886 | Nicotiana rotundifolia plastid matK gene for maturase K | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 66 | ON982153 | Nicotiana glauca voucher PE CPG28924 Z.D. Chen et al. 28924 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 67 | AB040006 | Nicotiana noctiflora var. noctiflora chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 68 | OM671261 | Nicotiana glauca isolate MSH-NG4-MatK-AB-SA maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 69 | OM646550 | Nicotiana glauca isolate MSH-NG9 maturase K gene, partial cds; chloroplast | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 70 | AB040007 | Nicotiana noctiflora var. albiflora chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 71 | AB040011 | Nicotiana linearis chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 72 | OL537924 | Nicotiana glauca voucher BRIT:Gostel813 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 73 | AB039987 | Nicotiana glauca chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 74 | AJ585884 | Nicotiana maritima plastid matK gene for maturase K | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 75 | NC_056979 | Nicotiana glauca chloroplast, complete genome | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 76 | AB040013 | Nicotiana nudicaulis chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 77 | AB040021 | Nicotiana megalosiphon chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 78 | AB040010 | Nicotiana miersii chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 79 | AJ585885 | Nicotiana rosulata plastid matK gene for maturase K | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 80 | BK010740 | TPA_asm: Nicotiana glauca chloroplast, complete genome | 732 | 100.0% | 1411.86 | 0.00e+00 | 99.3% |
| 81 | AM889733 | Nicotiana noctiflora chloroplast partial matK gene for maturase K | 717 | 98.0% | 1382.13 | 0.00e+00 | 99.3% |
| 82 | GQ248167 | Nicotiana noctiflora voucher Lim 005 (BM) maturase K (matk) gene, partial cds; chloroplast | 713 | 97.4% | 1374.2 | 0.00e+00 | 99.3% |
| 83 | JF270870 | Nicotiana glauca voucher OM2010 maturase K (matK) gene, partial cds | 709 | 96.9% | 1366.27 | 0.00e+00 | 99.3% |
| 84 | AB040016 | Nicotiana cavicola chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 85 | JN563930 | Synthetic construct Nicotiana undulata chloroplast clone pCK2-6, complete sequence | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 86 | AJ585844 | Nicotiana arentsii plastid matK gene for maturase K | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 87 | AB040023 | Nicotiana fragrans chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 88 | AJ585843 | Nicotiana wigandioides plastid matK gene for maturase K | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 89 | AJ585848 | Nicotiana miersii plastid matK gene for maturase K | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 90 | NC_016068 | Nicotiana undulata chloroplast, complete genome | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 91 | AB039996 | Nicotiana undulata chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 92 | AJ585837 | Nicotiana attenuata plastid matK gene for maturase K | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 93 | AB039990 | Nicotiana solanifolia chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1403.93 | 0.00e+00 | 99.2% |
| 94 | GQ248168 | Nicotiana petunioides voucher Lim 001 (BM) maturase K (matk) gene, partial cds; chloroplast | 714 | 97.5% | 1370.24 | 0.00e+00 | 99.2% |
| 95 | AJ585852 | Nicotiana corymbosa plastid matK gene for maturase K | 732 | 100.0% | 1396.01 | 0.00e+00 | 99.0% |
| 96 | AB039991 | Nicotiana benavidesii chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1396.01 | 0.00e+00 | 99.0% |
| 97 | XR_001650006 | PREDICTED: Nicotiana tabacum uncharacterized lncRNA (LOC107794931), ncRNA | 732 | 100.0% | 1394.02 | 0.00e+00 | 99.0% |
| 98 | AB039995 | Nicotiana glutinosa chloroplast gene for maturase K, complete cds | 730 | 99.7% | 1392.04 | 0.00e+00 | 99.0% |
| 99 | AJ585851 | Nicotiana cordifolia plastid matK gene for maturase K | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 100 | AJ585840 | Nicotiana raimondii plastid matK gene for maturase K | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 101 | AJ585846 | Nicotiana otophora plastid matK gene for maturase K | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 102 | NC_029746 | Iochroma cardenasianum chloroplast, complete genome | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 103 | NC_032724 | Nicotiana otophora chloroplast, complete genome | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 104 | MK077749 | Nicotiana solanifolia maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 105 | AJ585888 | Nicotiana thyrsiflora plastid matK gene for maturase K | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 106 | AB039985 | Nicotiana acaulis chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 107 | AB039994 | Nicotiana otophora chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1388.08 | 0.00e+00 | 98.9% |
| 108 | KP756821 | Trompettia cardenasiana isolate R046 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1384.11 | 0.00e+00 | 98.8% |
| 109 | AB039993 | Nicotiana tomentosa chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1380.15 | 0.00e+00 | 98.8% |
| 110 | AJ585847 | Nicotiana tomentosiformis plastid matK gene for maturase K | 732 | 100.0% | 1380.15 | 0.00e+00 | 98.8% |
| 111 | NC_007602 | Nicotiana tomentosiformis chloroplast, complete genome | 732 | 100.0% | 1380.15 | 0.00e+00 | 98.8% |
| 112 | JN559758 | Nicotiana tabacum clone nupt1b psbA and matK pseudogenes, complete sequence | 732 | 100.0% | 1376.18 | 0.00e+00 | 98.6% |
| 113 | MN910935 | Lycium ferocissimum isolate EC26.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 114 | MN910827 | Lycium ferocissimum isolate AU27.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 115 | MN910887 | Lycium ferocissimum isolate EC7.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 116 | MN910852 | Lycium ferocissimum isolate AU36.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 117 | PQ835009 | Lycium chinense isolate zlnmu2022302-1 voucher NMU01351 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 118 | MN910755 | Lycium ferocissimum isolate AU3.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 119 | MN910783 | Lycium ferocissimum isolate AU12.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 120 | PV013674 | Lycium barbarum isolate zcp202528 voucher zlnmu2022308 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 121 | AB040012 | Nicotiana bigelovii chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 122 | MN910932 | Lycium ferocissimum isolate EC25.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 123 | MN910878 | Lycium ferocissimum isolate EC2.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 124 | MN910824 | Lycium ferocissimum isolate AU26.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 125 | AJ585845 | Nicotiana kawakamii plastid matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 126 | PP239399 | Lycium dasystemum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 127 | PP239401 | Lycium barbarum var. auranticarpum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 128 | MN910913 | Lycium ferocissimum isolate EC19.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 129 | MN910904 | Lycium ferocissimum isolate EC15.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 130 | MN910946 | Lycium ferocissimum isolate WC8 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 131 | MN910805 | Lycium ferocissimum isolate AU20.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 132 | MN910961 | Lycium ferocissimum isolate WC18 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 133 | MN910823 | Lycium ferocissimum isolate AU26.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 134 | MN910786 | Lycium ferocissimum isolate AU13.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 135 | MN910764 | Lycium ferocissimum isolate AU6.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 136 | NC_029833 | Iochroma australe chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 137 | MN910802 | Lycium ferocissimum isolate AU19.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 138 | MN910903 | Lycium ferocissimum isolate EC15.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 139 | MN910822 | Lycium ferocissimum isolate AU25.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 140 | MN910846 | Lycium ferocissimum isolate AU34.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 141 | MN910863 | Lycium ferocissimum isolate AU39.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 142 | MN910765 | Lycium ferocissimum isolate AU6.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 143 | MN910789 | Lycium ferocissimum isolate AU14.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 144 | MN910772 | Lycium ferocissimum isolate AU8.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 145 | MN910881 | Lycium ferocissimum isolate EC2.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 146 | MN910816 | Lycium ferocissimum isolate AU23.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 147 | MN910929 | Lycium ferocissimum isolate EC24 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 148 | KP756814 | Eriolarynx australis isolate R039 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 149 | MN910956 | Lycium ferocissimum isolate WC14.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 150 | MN910754 | Lycium ferocissimum isolate AU3.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 151 | MN910760 | Lycium ferocissimum isolate AU4.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 152 | MN910784 | Lycium ferocissimum isolate AU12.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 153 | MN910866 | Lycium ferocissimum isolate AU40.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 154 | MN910857 | Lycium ferocissimum isolate AU37.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 155 | MN910785 | Lycium ferocissimum isolate AU13.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 156 | NC_086881 | Lycium yunnanense chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 157 | NC_030177 | Iochroma ellipticum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 158 | MN910958 | Lycium ferocissimum isolate WC15 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 159 | MN910762 | Lycium ferocissimum isolate AU5.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 160 | MN910877 | Lycium ferocissimum isolate EC1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 161 | AJ585874 | Anthocercis myosotidea plastid partial matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 162 | MN910954 | Lycium ferocissimum isolate WC13 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 163 | AB039997 | Nicotiana trigonophylla chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 164 | MN910838 | Lycium ferocissimum isolate AU31.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 165 | MN910950 | Lycium ferocissimum isolate WC10.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 166 | MN910811 | Lycium ferocissimum isolate AU22.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 167 | MN910853 | Lycium ferocissimum isolate AU36.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 168 | MN910918 | Lycium ferocissimum isolate EC20.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 169 | MN910874 | Lycium ferocissimum isolate AU43.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 170 | MN910937 | Lycium ferocissimum isolate EC27.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 171 | MN910876 | Lycium ferocissimum isolate AU43.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 172 | MN910835 | Lycium ferocissimum isolate AU30.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 173 | MN910864 | Lycium ferocissimum isolate AU39.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 174 | MN910947 | Lycium ferocissimum isolate WC9 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 175 | OR400641 | Eriolarynx lorentzii chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 176 | PQ835010 | Lycium chinense isolate zlnmu2022302-2 voucher NMU01351 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 177 | MN910814 | Lycium ferocissimum isolate AU23.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 178 | MN910828 | Lycium ferocissimum isolate AU27.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 179 | KP756817 | Saracha punctata isolate R042 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 180 | MN910891 | Lycium ferocissimum isolate EC8.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 181 | MN910921 | Lycium ferocissimum isolate EC21.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 182 | MN910907 | Lycium ferocissimum isolate EC16.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 183 | MN910771 | Lycium ferocissimum isolate AU8.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 184 | MN910818 | Lycium ferocissimum isolate AU24.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 185 | MN910787 | Lycium ferocissimum isolate AU13.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 186 | MN910882 | Lycium ferocissimum isolate EC3.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 187 | MN910926 | Lycium ferocissimum isolate EC23.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 188 | MN910774 | Lycium ferocissimum isolate AU9.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 189 | OL690150 | Salpichroa origanifolia voucher MO:Carlsen3163 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 190 | AJ585857 | Anthocercis angustifolia plastid matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 191 | MN910859 | Lycium ferocissimum isolate AU38.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 192 | MN910895 | Lycium ferocissimum isolate EC11.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 193 | MN910936 | Lycium ferocissimum isolate EC27.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 194 | MN910875 | Lycium ferocissimum isolate AU43.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 195 | MN910901 | Lycium ferocissimum isolate EC13.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 196 | MN910782 | Lycium ferocissimum isolate AU12.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 197 | MN910826 | Lycium ferocissimum isolate AU27.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 198 | MN910908 | Lycium ferocissimum isolate EC18.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 199 | OM937146 | Lycium sp. clone V12L0135 1haohuang maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 200 | MN910795 | Lycium ferocissimum isolate AU16.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 201 | MN910794 | Lycium ferocissimum isolate AU16.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 202 | MN910862 | Lycium ferocissimum isolate AU39.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 203 | PP239392 | Lycium barbarum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 204 | AB036621 | Lycium pilifolium chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 205 | PV013669 | Lycium barbarum isolate zcp202523 voucher zlnmu2022282 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 206 | MN910899 | Lycium ferocissimum isolate EC13.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 207 | KP756816 | Vassobia dichotoma isolate R041 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 208 | MN910752 | Lycium ferocissimum isolate AU2.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 209 | AB036648 | Nolana rostrata chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 210 | MK040922 | Lycium chinense plastid, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 211 | MN910854 | Lycium ferocissimum isolate AU36.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 212 | MN910894 | Lycium ferocissimum isolate EC11.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 213 | MN910800 | Lycium ferocissimum isolate AU18.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 214 | MN910798 | Lycium ferocissimum isolate AU17.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 215 | MN910815 | Lycium ferocissimum isolate AU23.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 216 | MN910909 | Lycium ferocissimum isolate EC18.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 217 | MN910927 | Lycium ferocissimum isolate EC23.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 218 | MN910919 | Lycium ferocissimum isolate EC21.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 219 | MN910841 | Lycium ferocissimum isolate AU32.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 220 | KP747438 | Saracha punctata voucher Barboza & Carrizo Garcia 3652 maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 221 | MN910763 | Lycium ferocissimum isolate AU5.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 222 | MN910821 | Lycium ferocissimum isolate AU25.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 223 | MN910931 | Lycium ferocissimum isolate EC25.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 224 | MN910804 | Lycium ferocissimum isolate AU19.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 225 | MN910963 | Lycium ferocissimum isolate WC20.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 226 | MN910778 | Lycium ferocissimum isolate AU10.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 227 | MN910880 | Lycium ferocissimum isolate EC2.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 228 | MN910955 | Lycium ferocissimum isolate WC14.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 229 | AB036639 | Lycium europaeum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 230 | MN910770 | Lycium ferocissimum isolate AU7.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 231 | AJ585838 | Nicotiana palmeri plastid matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 232 | PV013671 | Lycium barbarum isolate zcp202525 voucher zlnmu2022308 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 233 | AJ585864 | Anthotroche blackii plastid matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 234 | AJ585866 | Anthotroche pannosa plastid partial matK gene for maturase K | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 235 | MN910959 | Lycium ferocissimum isolate WC16.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 236 | MN910790 | Lycium ferocissimum isolate AU14.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 237 | PQ835020 | Lycium dasystemum isolate zlnmu2023271-1 voucher NMU02195 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 238 | MN910817 | Lycium ferocissimum isolate AU24.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 239 | PV013673 | Lycium barbarum isolate zcp202527 voucher zlnmu2022308 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 240 | MN910832 | Lycium ferocissimum isolate AU29.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 241 | MN910812 | Lycium ferocissimum isolate AU22.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 242 | NC_030056 | Acnistus arborescens x Iochroma cyaneum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 243 | MN910834 | Lycium ferocissimum isolate AU30.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 244 | MN956616 | Lycium hybrid cultivar clone V12L0065 Qin 8-2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 245 | NC_026567 | Iochroma nitidum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 246 | MN910925 | Lycium ferocissimum isolate EC22.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 247 | MN910868 | Lycium ferocissimum isolate AU41.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 248 | MN910886 | Lycium ferocissimum isolate EC7.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 249 | MN910905 | Lycium ferocissimum isolate EC15.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 250 | KP294521 | Vassobia dichotoma chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 251 | MN910793 | Lycium ferocissimum isolate AU15.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 252 | MN910825 | Lycium ferocissimum isolate AU26.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 253 | MN910855 | Lycium ferocissimum isolate AU37.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 254 | MN910965 | Lycium ferocissimum isolate WC21 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 255 | MN910924 | Lycium ferocissimum isolate EC22.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 256 | MN102357 | Lycium chinense chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 257 | MN910900 | Lycium ferocissimum isolate EC13.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 258 | MN910792 | Lycium ferocissimum isolate AU15.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 259 | NC_041110 | Lycium barbarum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 260 | MN910757 | Lycium ferocissimum isolate AU4.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 261 | MN910889 | Lycium ferocissimum isolate EC8.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 262 | MN910819 | Lycium ferocissimum isolate AU24.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 263 | MN910807 | Lycium ferocissimum isolate AU20.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 264 | MN910944 | Lycium ferocissimum isolate WC5.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 265 | NC_030171 | Eriolarynx fasciculata chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 266 | PQ835003 | Lycium barbarum isolate zlnmu2022282-1 voucher NMU01291 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 267 | OK323214 | Lycium barbarum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 268 | MN910847 | Lycium ferocissimum isolate AU34.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 269 | MN910769 | Lycium ferocissimum isolate AU7.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 270 | MN910898 | Lycium ferocissimum isolate EC12.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 271 | MN910952 | Lycium ferocissimum isolate WC12.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 272 | AB036623 | Lycium cinereum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 273 | MN910884 | Lycium ferocissimum isolate EC3.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 274 | MN910791 | Lycium ferocissimum isolate AU15.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 275 | MN910801 | Lycium ferocissimum isolate AU18.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 276 | MN910761 | Lycium ferocissimum isolate AU5.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 277 | MN910945 | Lycium ferocissimum isolate WC5.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 278 | PQ835018 | Lycium dasystemum var. rubricaulium isolate zlnmu2023274-1 voucher NMU02204 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 279 | MN910941 | Lycium ferocissimum isolate WC3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 280 | MN910768 | Lycium ferocissimum isolate AU7.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 281 | MN910803 | Lycium ferocissimum isolate AU19.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 282 | MN910809 | Lycium ferocissimum isolate AU21.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 283 | MN910911 | Lycium ferocissimum isolate EC19.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 284 | MN910912 | Lycium ferocissimum isolate EC19.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 285 | MN910775 | Lycium ferocissimum isolate AU9.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 286 | OL891645 | Lycium chinense chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 287 | MN910870 | Lycium ferocissimum isolate AU41.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 288 | MN910893 | Lycium ferocissimum isolate EC10 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 289 | MN910916 | Lycium ferocissimum isolate EC20.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 290 | MN910962 | Lycium ferocissimum isolate WC19 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 291 | PP239388 | Lycium dasystemum var. rubricaulium chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 292 | MN910758 | Lycium ferocissimum isolate AU4.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 293 | MN910806 | Lycium ferocissimum isolate AU20.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 294 | NC_030168 | Iochroma salpoanum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 295 | MN910759 | Lycium ferocissimum isolate AU4.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 296 | MN910836 | Lycium ferocissimum isolate AU30.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 297 | MN910767 | Lycium ferocissimum isolate AU7.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 298 | MN910943 | Lycium ferocissimum isolate WC5.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 299 | MN910953 | Lycium ferocissimum isolate WC12.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 300 | PQ835004 | Lycium barbarum isolate zlnmu2022308-1 voucher NMU01369 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 301 | KJ652182 | Lycium edgeworthii maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 302 | MN910796 | Lycium ferocissimum isolate AU16.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 303 | MN910777 | Lycium ferocissimum isolate AU10.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 304 | MN910753 | Lycium ferocissimum isolate AU2.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 305 | MN910938 | Lycium ferocissimum isolate WC1.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 306 | MN910843 | Lycium ferocissimum isolate AU33.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 307 | AB036629 | Lycium australe chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 308 | MN910949 | Lycium ferocissimum isolate WC10.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 309 | MN910869 | Lycium ferocissimum isolate AU41.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 310 | MN910960 | Lycium ferocissimum isolate WC16.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 311 | NC_026906 | Dunalia brachyacantha chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 312 | MN910867 | Lycium ferocissimum isolate AU40.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 313 | MN910776 | Lycium ferocissimum isolate AU10.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 314 | MN910948 | Lycium ferocissimum isolate WC10.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 315 | MN910779 | Lycium ferocissimum isolate AU11.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 316 | MN910883 | Lycium ferocissimum isolate EC3.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 317 | MN910831 | Lycium ferocissimum isolate AU29.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 318 | NC_042204 | Lycium chinense chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 319 | MN910858 | Lycium ferocissimum isolate AU38.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 320 | MN910829 | Lycium ferocissimum isolate AU28.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 321 | MN910833 | Lycium ferocissimum isolate AU29.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 322 | KP747437 | Dunalia brachyacantha voucher Barboza et al 3653 maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 323 | MN910820 | Lycium ferocissimum isolate AU25.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 324 | MN910885 | Lycium ferocissimum isolate EC3.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 325 | MN910872 | Lycium ferocissimum isolate AU42.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 326 | MN910751 | Lycium ferocissimum isolate AU2.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 327 | MN910813 | Lycium ferocissimum isolate AU22.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 328 | MN910781 | Lycium ferocissimum isolate AU11.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 329 | MN910849 | Lycium ferocissimum isolate AU35.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 330 | MN910951 | Lycium ferocissimum isolate WC11 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 331 | MK898293 | Lycium hybrid cultivar isolate LYCHI6401050017 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 332 | MN910939 | Lycium ferocissimum isolate WC1.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 333 | MN910749 | Lycium ferocissimum isolate AU1.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 334 | MW110854 | Lycium barbarum voucher H0027 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 335 | MN910902 | Lycium ferocissimum isolate EC14 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 336 | MN910840 | Lycium ferocissimum isolate AU32.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 337 | MN910850 | Lycium ferocissimum isolate AU35.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 338 | MN910799 | Lycium ferocissimum isolate AU18.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 339 | MN910842 | Lycium ferocissimum isolate AU33.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 340 | OP866962 | Lycium ruthenicum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 341 | MN910766 | Lycium ferocissimum isolate AU6.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 342 | KP756812 | Iochroma peruvianum isolate R035 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 343 | MN910879 | Lycium ferocissimum isolate EC2.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 344 | PV013665 | Lycium barbarum isolate zcp202519 voucher zlnmu2022044 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 345 | MN910888 | Lycium ferocissimum isolate EC7.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 346 | AB036637 | Lycium chinense chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 347 | MN910788 | Lycium ferocissimum isolate AU14.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 348 | NC_026574 | Iochroma stenanthum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 349 | MN910860 | Lycium ferocissimum isolate AU38.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 350 | MN910923 | Lycium ferocissimum isolate EC22.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 351 | MZ476908 | Lycium mascarenense isolate IE020 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 352 | MN910906 | Lycium ferocissimum isolate EC16.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 353 | NC_026726 | Iochroma loxense chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 354 | MN910810 | Lycium ferocissimum isolate AU21.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 355 | MN866909 | Lycium ferocissimum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 356 | MN910865 | Lycium ferocissimum isolate AU40.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 357 | MN910920 | Lycium ferocissimum isolate EC21.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 358 | MN910930 | Lycium ferocissimum isolate EC25.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 359 | MN910928 | Lycium ferocissimum isolate EC23.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 360 | MH168729 | Lycium shawii voucher BAHMP007280316R maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 361 | MN910890 | Lycium ferocissimum isolate EC8.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 362 | MN910934 | Lycium ferocissimum isolate EC26.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 363 | MN910830 | Lycium ferocissimum isolate AU28.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 364 | PQ824997 | Lycium shawii chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 365 | NC_030185 | Acnistus arborescens chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 366 | MN910922 | Lycium ferocissimum isolate EC21.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 367 | MN910848 | Lycium ferocissimum isolate AU34.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 368 | MN910797 | Lycium ferocissimum isolate AU17.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 369 | OM937164 | Lycium sp. clone V12L0127 Qin No.8 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 370 | MN910871 | Lycium ferocissimum isolate AU42.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 371 | MN910756 | Lycium ferocissimum isolate AU3.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 372 | MN910940 | Lycium ferocissimum isolate WC2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 373 | MN910837 | Lycium ferocissimum isolate AU31.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 374 | MN910915 | Lycium ferocissimum isolate EC20.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 375 | MN910957 | Lycium ferocissimum isolate WC14.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 376 | MN910773 | Lycium ferocissimum isolate AU8.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 377 | MN910964 | Lycium ferocissimum isolate WC20.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 378 | PV013666 | Lycium barbarum isolate zcp202520 voucher zlnmu2022044 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 379 | NC_067978 | Lycium dasystemum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 380 | OR400642 | Nothocestrum latifolium chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 381 | MN910910 | Lycium ferocissimum isolate EC18.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 382 | MN910851 | Lycium ferocissimum isolate AU35.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 383 | MN910839 | Lycium ferocissimum isolate AU31.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 384 | MN910873 | Lycium ferocissimum isolate AU42.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 385 | MN910856 | Lycium ferocissimum isolate AU37.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 386 | MN910845 | Lycium ferocissimum isolate AU34.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 387 | MN910861 | Lycium ferocissimum isolate AU39.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 388 | MN910892 | Lycium ferocissimum isolate EC9 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 389 | MN910917 | Lycium ferocissimum isolate EC20.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 390 | MN910780 | Lycium ferocissimum isolate AU11.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 391 | MN910897 | Lycium ferocissimum isolate EC12.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 392 | MN910750 | Lycium ferocissimum isolate AU1.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 393 | NC_086885 | Lycium cylindricum chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 394 | AB036640 | Lycium ferocissimum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 395 | MN910808 | Lycium ferocissimum isolate AU21.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 396 | MN910896 | Lycium ferocissimum isolate EC11.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 397 | MN910942 | Lycium ferocissimum isolate WC4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 398 | MN910914 | Lycium ferocissimum isolate EC19.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 399 | AB036624 | Lycium villosum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 400 | PQ835028 | Lycium truncatum isolate zlnmu2023250-1 voucher NMU02132 chloroplast, complete genome | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 401 | MN910933 | Lycium ferocissimum isolate EC26.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 402 | MN910844 | Lycium ferocissimum isolate AU33.3 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 403 | OM937162 | Lycium sp. clone V12L0126 Qin No.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1372.22 | 0.00e+00 | 98.6% |
| 404 | OM937147 | Lycium sp. clone V12L0136 14-420 maturase K (matK) gene, partial cds; chloroplast | 730 | 99.7% | 1368.25 | 0.00e+00 | 98.6% |
| 405 | AB036622 | Lycium schizocalyx chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 406 | KP089142 | Lycium barbarum voucher BOP010138 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 407 | AB036635 | Lycium carolinianum var. carolinianum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 408 | MG833706 | Acnistus arborescens isolate JGK1026 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 409 | AB036641 | Lycium morongii chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 410 | MF694891 | Withania somnifera voucher DFC034 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 411 | PP239397 | Lycium chinense chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 412 | BK010737 | TPA_asm: Nicotiana knightiana chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 413 | OR400638 | Brachistus nelsonii chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 414 | OM937155 | Lycium sp. clone V12L0144 161691 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 415 | MW409657 | Lycium barbarum isolate 257 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 416 | KU310654 | Iochroma lehmannii plastid, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 417 | AJ585873 | Cyphanthera microphylla plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 418 | AJ585867 | Anthotroche walcottii plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 419 | NC_030044 | Iochroma umbellatum chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 420 | AB036620 | Lycium prunus-spinosa chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 421 | NC_026694 | Saracha punctata chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 422 | AB039989 | Nicotiana knightiana chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 423 | OM967064 | Lycium sp. clone V12L0134 Qin No.2 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 424 | AJ585865 | Anthotroche myoporoides plastid partial matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 425 | PQ835002 | Lycium amarum isolate zlnmu2023167-3 voucher NMU01886 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 426 | NC_086884 | Lycium amarum chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 427 | OM937142 | Lycium barbarum clone V12L0052 Ningqi No.8 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 428 | AJ585850 | Nicotiana clevelandii plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 429 | PQ835016 | Lycium cylindricum isolate zlnmu2023268-3 voucher NMU02187 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 430 | MH107772 | Datura inoxia isolate DIF maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 431 | BK010739 | TPA_asm: Nicotiana obtusifolia chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 432 | OM616890 | Datura inoxia isolate MSH-DI39 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 433 | MG947040 | Withania frutescens maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 434 | MN276012 | Lycium chinense clone V12L0012 Zhongguo gouqi maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 435 | NC_027177 | Iochroma tingoanum chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 436 | OM937161 | Lycium sp. clone V12L0048 Baitiao maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 437 | AJ585870 | Cyphanthera albicans plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 438 | MH285783 | Datura stramonium isolate DUM maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 439 | JX996065 | Datura inoxia maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 440 | MN078341 | Lycium barbarum clone V12L0004 Ningqi No.4 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 441 | KU556671 | Datura stramonium isolate MGGM_AGERI_171 maturase K (matk) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 442 | NC_030167 | Iochroma lehmannii chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 443 | PQ835011 | Lycium chinense var. potaninii isolate zlnmu2023264-2 voucher NMU02174 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 444 | KP756820 | Iochroma cyaneum isolate R043 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 445 | MW409655 | Lycium barbarum isolate 255 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 446 | AB039988 | Nicotiana paniculata chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 447 | NC_027099 | Dunalia solanacea chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 448 | OM967059 | Lycium sp. clone V12L0141 16-17-5-11 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 449 | MN956621 | Lycium hybrid cultivar clone V12L0047 Tingjing No.5 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 450 | MZ476907 | Lycium elliotii isolate IE019 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 451 | OR343816 | Lycium schweinfurthii maturase K (matK) gene, partial cds; plastid | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 452 | AJ585861 | Anthocercis intricata plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 453 | NC_026563 | Dunalia obovata chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 454 | MZ823077 | Nicotiana knightiana maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 455 | PQ835027 | Lycium truncatum isolate zlnmu2023256-1 voucher NMU02150 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 456 | OM937163 | Lycium sp. clone V12L0051 Jingqi No.5 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 457 | PV013647 | Lycium chinense isolate zcp202501 voucher zlnmu2022198 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 458 | NC_068894 | Withania frutescens chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 459 | NC_086880 | Lycium truncatum chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 460 | AJ585862 | Anthocercis sylvicola plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 461 | MK520246 | Leucophysalis grandiflora voucher v0255486WIS maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 462 | KX789381 | Lycium shawii voucher M222 maturase K (matK) gene, partial cds; plastid | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 463 | AB039992 | Nicotiana rustica chloroplast gene for maturase K, complete cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 464 | AJ585863 | Anthocercis viscosa plastid matK gene for maturase K | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 465 | PV078024 | Mandragora officinarum voucher personal collection:JeremyBechelli:04-SSU chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 466 | PQ835001 | Lycium amarum isolate zlnmu2023167-2 voucher NMU01885 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 467 | AB036643 | Lycium ruthenicum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 468 | AB036647 | Nolana albescens chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 469 | PQ835015 | Lycium cylindricum isolate zlnmu2023268-2 voucher NMU02186 chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 470 | PV078023 | Mandragora turcomanica voucher personal collection:JeremyBechelli:06-SSU chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 471 | AB036630 | Lycium barbarum chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 472 | OM937154 | Lycium sp. clone V12L0143 16111520 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 473 | KP756819 | Saracha nigribaccata isolate R042 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 474 | OR360843 | Trozelia umbellata chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 475 | BK010738 | TPA_asm: Nicotiana rustica chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 476 | MW409658 | Lycium barbarum isolate 258 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 477 | MW409656 | Lycium barbarum isolate 256 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 478 | KU306396 | Iochroma cyaneum chloroplast, complete genome | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.5% |
| 479 | KP756818 | Iochroma calycinum isolate R043 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1364.29 | 0.00e+00 | 98.4% |
| 480 | KP756842 | Solandra longiflora isolate R096 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1360.32 | 0.00e+00 | 98.4% |
| 481 | MN956612 | Lycium hybrid cultivar clone V12L0105 Yiselie maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 482 | OM937158 | Lycium sp. clone V12L0148 162289 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 483 | MH045575 | Alkekengi officinarum var. franchetii chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 484 | AB036636 | Lycium cestroides chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 485 | MT610897 | Datura stramonium chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 486 | MK244353 | Withania coagulans voucher QRI 538 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 487 | AB036628 | Lycium andersonii chloroplast matK gene for maturase K, partial cds | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 488 | OM937152 | Lycium barbarum clone V12L0056 QixinNo.1 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 489 | OP846044 | Lycium barbarum var. auranticarpum chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 490 | OQ289770 | Witheringia solanacea voucher Canek Ledesma 20483 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 491 | MN006755 | Withania sp. CCMB H59 voucher CCMB-30-133-H59 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 492 | OM937148 | Lycium sp. clone V12L0137 09-191 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 493 | EF537319 | Aureliana fasciculata var. fasciculata isolate 61 maturase K (matK) gene, complete cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 494 | PP239390 | Lycium chinense var. potaninii chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 495 | PV013653 | Lycium ruthenicum isolate zcp202507 voucher zlnmu2022235 chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 496 | OR166175 | Withania somnifera chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 497 | HM851091 | Datura stramonium maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 498 | PV013652 | Lycium ruthenicum isolate zcp202506 voucher zlnmu2022235 chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 499 | MT955897 | Lycium ruthenicum chloroplast, complete genome | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
| 500 | MF159417 | Datura stramonium voucher Li ZY, Xiang XG 201507087 maturase K (matK) gene, partial cds; chloroplast | 732 | 100.0% | 1356.36 | 0.00e+00 | 98.4% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Nicotiana tabacum | species | Nicotiana tabacum | Nicotiana tabacum | AP019624 | 1.0 |
Database coverage of Taxon of Interest Nicotiana tabacumThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Nicotiana tabacum
Flag 5.1A:
The reference data supports this taxon well
20 records
There are 20 sequences in the reference database for Nicotiana tabacum at the given locus matK.
Global occurrence records for Nicotiana tabacum.
Database coverage of species in genus Nicotiana
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus matK Database coverage of species in genus Nicotiana that occur in country of origin Indonesia
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus matK |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |